After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DYNC1I1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010063.4
Размер кДНК:1887bp
Описание кДНК:Full length Clone DNA of Mus musculus dynein cytoplasmic 1 intermediate chain 1.
Синоним гена:DIC, IC74, DHIC-1, Dncic1, DH IC-1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51372-ACGRBS16764
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51372-ACRRBS16764
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51372-ANGRBS16764
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51372-ANRRBS16764
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51372-CFRBS14711
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51372-CHRBS14711
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51372-CMRBS14711
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51372-CYRBS14711
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51372-NFRBS14711
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51372-NHRBS14711
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51372-NMRBS14711
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51372-NYRBS14711
Мышь Dynein intermediate chain 1 Джин клон кДНК в вектор клонированияMG51372-URBS5132
Мышь Dynein intermediate chain 1 Джин ORF экспрессии кДНК клона плазмидыMG51372-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51372-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».