After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TNFRSF21 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_178589.3
Размер кДНК:1968bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 21.
Синоним гена:DR6, TR7, R74815, AA959878, Tnfrsf21
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50263-ACGRBS16764
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50263-ACRRBS16764
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50263-CFRBS14711
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50263-CHRBS14711
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50263-CMRBS14711
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50263-CYRBS14711
Мышь TNFRSF21/DR6 Джин клон кДНК в вектор клонированияMG50263-MRBS5132
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50263-NFRBS14711
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50263-NHRBS14711
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50263-NMRBS14711
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50263-NYRBS14711
Мышь TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмидыMG50263-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors called death receptors. This type I transmembrane receptor possesses four extracellular cysteine-rich motifs and a cytoplasmic death domain. DR6 is an extensively posttranslationally modified transmembrane protein and that N- and O-glycosylations of amino acids in its extracellular part. DR6 interacts with the adaptor protein TRADD and mediates signal transduction through its death domain, and expression of DR6 in mammalian cells induces activation of both NF-kappaB and JNK and cell apoptosis. DR6 knockout mice have enhanced CD4+ T cell proliferation and Th2 cytokine production, suggested that DR6 serves as an important regulatory molecule in T-helper cell activation, and is involved in inflammation and immune regulation. DR6 is expressed ubiquitously with high expression in lymphoid organs, heart, brain and pancreas. Some tumor cells overexpress DR6, typically in conjunction with elevated anti-apoptosis molecules. DR6 may also be involved in tumor cell survival and immune evasion, which is subject to future investigations.

Ссылки
  • Pan G, et al. (1998) Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett. 431(3): 351-6.
  • Benschop R, et al. (2009) Tumor necrosis factor receptor superfamily member 21: TNFR-related death receptor-6, DR6. Adv Exp Med Biol. 647: 186-94.
  • Klma M, et al. (2009) Functional analysis of the posttranslational modifications of the death receptor 6. Biochim Biophys Acta. 1793(10): 1579-87.
  • Size / Price
    Каталог: MG50263-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».