Быстрый заказ

Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь DPT Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_019759.2
    Размер кДНК:606bp
    Описание кДНК:Full length Clone DNA of Mus musculus dermatopontin.
    Синоним гена:Eq1, EQ-1, 1810032B19Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DPT qPCR primers for gene expression analysis, MP200295 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50270-ACGRBS15400
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50270-ACRRBS15400
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50270-CFRBS13340
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50270-CHRBS13340
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50270-CMRBS13340
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50270-CYRBS13340
    Мышь dermatopontin Джин клон кДНК в вектор клонированияMG50270-MRBS5130
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50270-NFRBS13340
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50270-NHRBS13340
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50270-NMRBS13340
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50270-NYRBS13340
    Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмидыMG50270-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG50270-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».