After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DPT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019759.2
Размер кДНК:606bp
Описание кДНК:Full length Clone DNA of Mus musculus dermatopontin.
Синоним гена:Eq1, EQ-1, 1810032B19Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50270-ACGRBS15400
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50270-ACRRBS15400
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50270-CFRBS13340
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50270-CHRBS13340
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50270-CMRBS13340
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50270-CYRBS13340
Мышь dermatopontin Джин клон кДНК в вектор клонированияMG50270-MRBS5130
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50270-NFRBS13340
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50270-NHRBS13340
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50270-NMRBS13340
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50270-NYRBS13340
Мышь dermatopontin Джин ORF экспрессии кДНК клона плазмидыMG50270-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50270-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».