After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DPP7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031843.2
Размер кДНК:1521bp
Описание кДНК:Full length Clone DNA of Mus musculus dipeptidylpeptidase 7 with C terminal Flag tag.
Синоним гена:QPP, Dpp2, DPPII, Dpp7
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51019-ACGRBS16760
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51019-ACRRBS16760
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51019-CFRBS14710
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51019-CHRBS14710
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51019-CMRBS14710
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51019-CYRBS14710
Мышь DPP7 / DPPII / DPP2 Джин клон кДНК в вектор клонированияMG51019-GRBS5130
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51019-NFRBS14710
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51019-NHRBS14710
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51019-NMRBS14710
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51019-NYRBS14710
Мышь DPP7 / DPPII / DPP2 Джин ORF экспрессии кДНК клона плазмидыMG51019-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. Dipeptidyl peptidases (DPPs) have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. DPPs mediate regulatory activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. DPPs can bind specific voltage-gated potassium channels and alter their expression and biophysical properties and may also influence T cells. DPP proteins include DPRP1, DPRP2, DPP3, DPP7, DPP10, DPPX and CD26. It localizes to lysosomes. DPP7 localizes to lysosomes and exists as a homodimer via its leucine zipper motif and is involved in the degradation of oligopeptides. In response to calcium release, it can be secreted in its active form. It is essential for lymphocyte survival, as the inhibition of DPP7 results in quiescent cell apoptosis.

Ссылки
  • Chiravuri M, et al. (1999) A novel apoptotic pathway in quiescent lymphocytes identified by inhibition of a post-proline cleaving aminodipeptidase: a candidate target protease, quiescent cell proline dipeptidase. J Immunol. 163(6):3092-9.
  • Fukasawa KM, et al. (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J. 353(Pt 2):283-90.
  • Fornas E, et al. (1992) Effect of cholesterol and its autooxidation derivatives on endocytosis and dipeptidyl peptidases of aortic endothelial cells. Histol Histopathol. 7(2):163-8.
  • Size / Price
    Каталог: MG51019-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».