Быстрый заказ

Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DNAJB11 Информация о продукте «Клон cDNA»
Размер кДНК:1077bp
Описание кДНК:Full length Clone DNA of Mus musculus DnaJ (Hsp40) homolog, subfamily B, member 11 with N terminal His tag.
Синоним гена:Dj9, ERdj3, ERj3p, ABBP-2, AL024055, 1810031F23Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51976-ACGRBS15400
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51976-ACRRBS15400
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51976-ANGRBS15400
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51976-ANRRBS15400
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51976-CFRBS13340
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51976-CHRBS13340
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51976-CMRBS13340
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51976-CYRBS13340
Мышь DNAJB11/ERdj3 Джин клон кДНК в вектор клонированияMG51976-GRBS5130
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51976-NFRBS13340
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51976-NHRBS13340
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51976-NMRBS13340
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51976-NYRBS13340
Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмидыMG51976-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51976-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.