Быстрый заказ

Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь DNAJB11 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001190805.1
    Размер кДНК:1077bp
    Описание кДНК:Full length Clone DNA of Mus musculus DnaJ (Hsp40) homolog, subfamily B, member 11 with N terminal His tag.
    Синоним гена:Dj9, ERdj3, ERj3p, ABBP-2, AL024055, 1810031F23Rik
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DNAJB11 qPCR primers for gene expression analysis, MP201849 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51976-ACGRBS15400
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51976-ACRRBS15400
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51976-ANGRBS15400
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51976-ANRRBS15400
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51976-CFRBS13340
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51976-CHRBS13340
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51976-CMRBS13340
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51976-CYRBS13340
    Мышь DNAJB11/ERdj3 Джин клон кДНК в вектор клонированияMG51976-GRBS5130
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51976-NFRBS13340
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51976-NHRBS13340
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51976-NMRBS13340
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51976-NYRBS13340
    Mouse DNAJB11/ERdj3 Gene ORF cDNA clone in cloning vectorMG51976-URBS5130
    Мышь DNAJB11/ERdj3 Джин ORF экспрессии кДНК клона плазмидыMG51976-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51976-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».