After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DHCR24 Информация о продукте «Клон cDNA»
Размер кДНК:1551 bp
Описание кДНК:Full length Clone DNA of Mus musculus 24-dehydrocholesterol reductase
Синоним гена:2310076D10Rik,5830417J06Rik,mKIAA0018
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51733-ACGRBS16760
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51733-ACRRBS16760
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51733-ANGRBS16760
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51733-ANRRBS16760
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51733-CFRBS5130
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51733-CHRBS14710
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51733-CMRBS14710
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51733-CYRBS14710
Mouse DHCR24 Gene cDNA clone plasmidMG51733-GRBS5130
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51733-NFRBS14710
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51733-NHRBS14710
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51733-NMRBS14710
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51733-NYRBS14710
Мышь Seladin 1 Джин клон кДНК в вектор клонированияMG51733-URBS5130
Мышь Seladin 1 Джин ORF экспрессии кДНК клона плазмидыMG51733-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51733-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.