Быстрый заказ

Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DDX52 Информация о продукте «Клон cDNA»
Размер кДНК:1797bp
Описание кДНК:Full length Clone DNA of Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 with N terminal His tag.
Синоним гена:ROK1, 2700029C06Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51969-ACGRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51969-ACRRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51969-ANGRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51969-ANRRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51969-CFRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51969-CHRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51969-CMRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51969-CYRBS14710
Мышь DDX52 Джин клон кДНК в вектор клонированияMG51969-GRBS5130
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51969-NFRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51969-NHRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51969-NMRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51969-NYRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмидыMG51969-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51969-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.