After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DDX52 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_030096.2
Размер кДНК:1797bp
Описание кДНК:Full length Clone DNA of Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 with N terminal His tag.
Синоним гена:ROK1, 2700029C06Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51969-ACGRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51969-ACRRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51969-ANGRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51969-ANRRBS16760
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51969-CFRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51969-CHRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51969-CMRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51969-CYRBS14710
Мышь DDX52 Джин клон кДНК в вектор клонированияMG51969-GRBS5130
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51969-NFRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51969-NHRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51969-NMRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51969-NYRBS14710
Мышь DDX52 Джин ORF экспрессии кДНК клона плазмидыMG51969-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51969-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».