Быстрый заказ

Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DDX42 Информация о продукте «Клон cDNA»
Размер кДНК:2790bp
Описание кДНК:Full length Clone DNA of Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 with N terminal HA tag.
Синоним гена:RHELP, RNAHP, SF3b125, AW319508, AW556242, 1810047H21Rik, B430002H05Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51992-ACGRBS22240
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51992-ACRRBS22240
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51992-ANGRBS22240
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51992-ANRRBS22240
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51992-CFRBS20190
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51992-CHRBS20190
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51992-CMRBS20190
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51992-CYRBS20190
Мышь DDX42 Джин клон кДНК в вектор клонированияMG51992-GRBS5130
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51992-NFRBS20190
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51992-NHRBS20190
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51992-NMRBS20190
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51992-NYRBS20190
Мышь DDX42 Джин ORF экспрессии кДНК клона плазмидыMG51992-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51992-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.