DDRGK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

DDRGK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
948 bp
Description
Full length Clone DNA of Mouse DDRGK domain containing 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DDRGK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

1110001I20Rik cDNA ORF Clone, Mouse; 2600009E05Rik cDNA ORF Clone, Mouse; AI326138 cDNA ORF Clone, Mouse; Ufbp1 cDNA ORF Clone, Mouse

DDRGK1 Background Information

DDRGK1 is a member of the DDRGK domain-containing protein family, DDRGK1 is an ER membrane protein and a critical component of the ubiquitin-fold modifier 1 (Ufm1) system and the depletion of DDRGK1 inhibits cell proliferation and invasion. DDRGK1 as an important regulator of the NF-kappaB pathway, Microarray analysis indicated that the expression of NF-kappaB target genes showed the most significant decrease after depleting of DDRGK1, suggesting that DDRGK1 may play an important role in the NF-kappaB signaling pathway.
Full Name
DDRGK domain containing 1
Add to Cart Successfully Add to Cart Failed