After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DDR2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022563.2
Размер кДНК:2565bp
Описание кДНК:Full length Clone DNA of Mus musculus discoidin domain receptor family, member 2 with N terminal HA tag.
Синоним гена:Ntrkr3, tyro10, AW495251, Ddr2
Виды:Mouse
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50541-ACGRBS22240
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50541-ACRRBS22240
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50541-CFRBS20190
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50541-CHRBS20190
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50541-CMRBS20190
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50541-CYRBS20190
Мышь DDR2/CD167b Джин клон кДНК в вектор клонированияMG50541-MRBS5130
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50541-NFRBS20190
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50541-NHRBS20190
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50541-NMRBS20190
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50541-NYRBS20190
Мышь DDR2/CD167b Джин ORF экспрессии кДНК клона плазмидыMG50541-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

Ссылки
et al.
  • Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.
  • Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.
  • Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.
  • Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.
  • Size / Price
    Каталог: MG50541-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».