Быстрый заказ

Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DDC Информация о продукте «Клон cDNA»
Размер кДНК:1443bp
Описание кДНК:Full length Clone DNA of Mus musculus dopa decarboxylase with N terminal Myc tag.
Синоним гена:Aadc, Ddc
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50799-ACGRBS15400
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50799-ACRRBS15400
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50799-ANGRBS15400
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50799-ANRRBS15400
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50799-CFRBS13340
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50799-CHRBS13340
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50799-CMRBS13340
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50799-CYRBS13340
Мышь DOPA Decarboxylase/DDC Джин клон кДНК в вектор клонированияMG50799-GRBS5130
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50799-NFRBS13340
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50799-NHRBS13340
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50799-NMRBS13340
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50799-NYRBS13340
Мышь DOPA Decarboxylase/DDC Джин ORF экспрессии кДНК клона плазмидыMG50799-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Каталог: MG50799-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.