After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DCTN4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK034292.1
Размер кДНК:1404bp
Описание кДНК:Full length Clone DNA of Mus musculus dynactin 4.
Синоним гена:p62, 1110001K06Rik, 4930547K17Rik, C130039E17Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51373-ACGRBS15400
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51373-ACRRBS15400
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51373-ANGRBS15400
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51373-ANRRBS15400
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51373-CFRBS13340
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51373-CHRBS13340
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51373-CMRBS13340
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51373-CYRBS13340
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51373-NFRBS13340
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51373-NHRBS13340
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51373-NMRBS13340
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51373-NYRBS13340
Мышь DCTN4 Джин клон кДНК в вектор клонированияMG51373-URBS5130
Мышь DCTN4 Джин ORF экспрессии кДНК клона плазмидыMG51373-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51373-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».