After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DCTN2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001190453.1
Размер кДНК:1215bp
Описание кДНК:Full length Clone DNA of Mus musculus dynactin 2.
Синоним гена:p50, RBP50, C87049, DCTN-50, GMP23-48K, 2310042E05Rik, C130077D06Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52475-ACGRBS15400
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52475-ACRRBS15400
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52475-ANGRBS15400
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52475-ANRRBS15400
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52475-CFRBS13340
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52475-CHRBS13340
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52475-CMRBS13340
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52475-CYRBS13340
Мышь Dynamitin/DCTN2 Джин клон кДНК в вектор клонированияMG52475-GRBS5130
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52475-NFRBS13340
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52475-NHRBS13340
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52475-NMRBS13340
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52475-NYRBS13340
Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмидыMG52475-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52475-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».