Быстрый заказ

Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь DCTN2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001190453.1
    Размер кДНК:1215bp
    Описание кДНК:Full length Clone DNA of Mus musculus dynactin 2.
    Синоним гена:p50, RBP50, C87049, DCTN-50, GMP23-48K, 2310042E05Rik, C130077D06Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DCTN2 qPCR primers for gene expression analysis, MP202348 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52475-ACGRBS15400
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52475-ACRRBS15400
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52475-ANGRBS15400
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52475-ANRRBS15400
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52475-CFRBS13340
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52475-CHRBS13340
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52475-CMRBS13340
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52475-CYRBS13340
    Мышь Dynamitin/DCTN2 Джин клон кДНК в вектор клонированияMG52475-GRBS5130
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52475-NFRBS13340
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52475-NHRBS13340
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52475-NMRBS13340
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52475-NYRBS13340
    Мышь Dynamitin/DCTN2 Джин ORF экспрессии кДНК клона плазмидыMG52475-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52475-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».