DAP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51407-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All DAP3 Reagents

CRO Services

Product recommended


All DAP3 Reagents

DAP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Mouse death associated protein 3

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DAP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

4921514D13Rik cDNA ORF Clone, Mouse;DAP-3 cDNA ORF Clone, Mouse;MRP-S29 cDNA ORF Clone, Mouse;S29mt cDNA ORF Clone, Mouse

DAP3 Background Information

Full Name
death associated protein 3

DAP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DAP3 cDNA ORF Clone in Cloning Vector, Mouse MG51407-U
DAP3 cDNA ORF Clone, Mouse, untagged MG51407-UT
DAP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51407-ACG
DAP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51407-ACGLN
DAP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51407-ANG
DAP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51407-ACR
DAP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51407-ANR
DAP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51407-NF
DAP3 cDNA ORF Clone, Mouse, C-His tag MG51407-CH
DAP3 cDNA ORF Clone, Mouse, N-His tag MG51407-NH
DAP3 cDNA ORF Clone, Mouse, C-HA tag MG51407-CY
DAP3 cDNA ORF Clone, Mouse, N-HA tag MG51407-NY
DAP3 cDNA ORF Clone, Mouse, C-Myc tag MG51407-CM
DAP3 cDNA ORF Clone, Mouse, N-Myc tag MG51407-NM
DAP3 qPCR Primer Pairs, Mouse MP201291

DAP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DAP3 cDNA ORF Clone in Cloning Vector, Human HG15768-G
DAP3 cDNA ORF Clone, Human, untagged HG15768-UT
DAP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15768-ACG
DAP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15768-ACGLN
DAP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15768-ANG
DAP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15768-ACR
DAP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15768-ANR
DAP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15768-CF
DAP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15768-NF
DAP3 cDNA ORF Clone, Human, C-His tag HG15768-CH
DAP3 cDNA ORF Clone, Human, N-His tag HG15768-NH
DAP3 cDNA ORF Clone, Human, C-HA tag HG15768-CY
DAP3 cDNA ORF Clone, Human, N-HA tag HG15768-NY
DAP3 cDNA ORF Clone, Human, C-Myc tag HG15768-CM
DAP3 cDNA ORF Clone, Human, N-Myc tag HG15768-NM
DAP3 qPCR Primer Pairs, Human HP104359
info info
添加购物车成功! 添加购物车失败!