After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DAP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022994.3
Размер кДНК:1191bp
Описание кДНК:Full length Clone DNA of Mus musculus death associated protein 3 with N terminal His tag.
Синоним гена:DAP-3; S29mt; MRP-S29; 4921514D13Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51407-ACGRBS15400
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51407-ACRRBS15400
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51407-ANGRBS15400
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51407-ANRRBS15400
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51407-CFRBS5130
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51407-CHRBS13340
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51407-CMRBS13340
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51407-CYRBS13340
Mouse DAP3 Gene cDNA clone plasmidMG51407-GRBS5130
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51407-NFRBS13340
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51407-NHRBS13340
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51407-NMRBS13340
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51407-NYRBS13340
Мышь DAP3 Джин клон кДНК в вектор клонированияMG51407-URBS5130
Мышь DAP3 Джин ORF экспрессии кДНК клона плазмидыMG51407-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51407-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».