Быстрый заказ

Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь D6WSU163E Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_138594.3
Размер кДНК:1659bp
Описание кДНК:Full length Clone DNA of Mus musculus DNA segment, Chr 6, Wayne State University 163, expressed.
Синоним гена:C12orf4
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with D6WSU163E qPCR primers for gene expression analysis, MP202327 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52454-ACGRBS16760
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52454-ACRRBS16760
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52454-ANGRBS16760
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52454-ANRRBS16760
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52454-CFRBS14710
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52454-CHRBS14710
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52454-CMRBS14710
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52454-CYRBS14710
Мышь D6WSU163E Джин клон кДНК в вектор клонированияMG52454-GRBS5130
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52454-NFRBS14710
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52454-NHRBS14710
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52454-NMRBS14710
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52454-NYRBS14710
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмидыMG52454-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52454-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».