After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse D6WSU163E Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_138594.3
Размер кДНК:1659bp
Описание кДНК:Full length Clone DNA of Mus musculus DNA segment, Chr 6, Wayne State University 163, expressed.
Синоним гена:C12orf4
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52454-ACGRBS16764
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52454-ACRRBS16764
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52454-ANGRBS16764
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52454-ANRRBS16764
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52454-CFRBS14711
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52454-CHRBS14711
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52454-CMRBS14711
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52454-CYRBS14711
Мышь D6WSU163E Джин клон кДНК в вектор клонированияMG52454-GRBS5132
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52454-NFRBS14711
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52454-NHRBS14711
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52454-NMRBS14711
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52454-NYRBS14711
Мышь D6WSU163E Джин ORF экспрессии кДНК клона плазмидыMG52454-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52454-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».