FAM204A cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

FAM204A cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Mouse DNA segment, Chr 19, ERATO Doi 737, expressed with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FAM204A cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

2310065H12Rik cDNA ORF Clone, Mouse; 2610015K05Rik cDNA ORF Clone, Mouse; D19Ertd737e cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait