After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse D030056L22RIK Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_177640.4
Размер кДНК:489bp
Описание кДНК:Full length Clone DNA of Mus musculus RIKEN cDNA D030056L22 gene with N terminal Myc tag.
Синоним гена:D030056L22Rik
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52014-ACGRBS15396
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52014-ACRRBS15396
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52014-ANGRBS15396
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52014-ANRRBS15396
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52014-CFRBS13343
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52014-CHRBS13343
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52014-CMRBS13343
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52014-CYRBS13343
Мышь D030056L22RIK Джин клон кДНК в вектор клонированияMG52014-GRBS5132
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52014-NFRBS13343
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52014-NHRBS13343
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52014-NMRBS13343
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52014-NYRBS13343
Мышь D030056L22RIK Джин ORF экспрессии кДНК клона плазмидыMG52014-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52014-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».