After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CYP7B1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007825.4
Размер кДНК:1524bp
Описание кДНК:Full length Clone DNA of Mus musculus cytochrome P450, family 7, subfamily b, polypeptide 1.
Синоним гена:hct-1, AW261589, D3Ertd552e
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52457-ACGRBS16760
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52457-ACRRBS16760
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52457-ANGRBS16760
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52457-ANRRBS16760
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52457-CFRBS14710
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52457-CHRBS14710
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52457-CMRBS14710
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52457-CYRBS14710
Мышь CYP7B1 Джин клон кДНК в вектор клонированияMG52457-GRBS5130
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52457-NFRBS14710
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52457-NHRBS14710
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52457-NMRBS14710
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52457-NYRBS14710
Мышь CYP7B1 Джин ORF экспрессии кДНК клона плазмидыMG52457-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52457-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».