After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CYC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025567.2
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Mus musculus cytochrome c-1.
Синоним гена:AA408921, 2610002H19Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52472-ACGRBS15400
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52472-ACRRBS15400
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52472-ANGRBS15400
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52472-ANRRBS15400
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52472-CFRBS13340
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52472-CHRBS13340
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52472-CMRBS13340
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52472-CYRBS13340
Мышь CYC1 Джин клон кДНК в вектор клонированияMG52472-GRBS5130
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52472-NFRBS13340
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52472-NHRBS13340
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52472-NMRBS13340
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52472-NYRBS13340
Мышь CYC1 Джин ORF экспрессии кДНК клона плазмидыMG52472-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52472-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».