After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CYB561A3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001282067.1
Размер кДНК:729bp
Описание кДНК:Full length Clone DNA of Mus musculus cytochrome b561 family, member A3 with C terminal His tag.
Синоним гена:Lcytb, Cybasc3, 2310004G04Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53039-ACGRBS15400
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53039-ACRRBS15400
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53039-ANGRBS15400
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53039-ANRRBS15400
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53039-CFRBS13340
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53039-CHRBS13340
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53039-CMRBS13340
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53039-CYRBS13340
Мышь CYB561A3 Джин клон кДНК в вектор клонированияMG53039-GRBS5130
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53039-NFRBS13340
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53039-NHRBS13340
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53039-NMRBS13340
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53039-NYRBS13340
Мышь CYB561A3 Джин ORF экспрессии кДНК клона плазмидыMG53039-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG53039-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».