After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CXCL5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009141.2
Размер кДНК:399bp
Описание кДНК:Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 5 with C terminal Myc tag.
Синоним гена:LIX, GCP-2, Scyb5, Scyb6, ENA-78, AMCF-II, Cxcl5
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50354-ACGRBS15400
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50354-ACRRBS15400
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50354-CFRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50354-CHRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50354-CMRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50354-CYRBS13340
Мышь CXCL5 Джин клон кДНК в вектор клонированияMG50354-MRBS5130
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50354-M-HRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50354-NFRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50354-NHRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50354-NMRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50354-NYRBS13340
Мышь CXCL5 Джин ORF экспрессии кДНК клона плазмидыMG50354-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CXCL5 is a small cytokine belonging to the CXC chemokine family. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL5 is produced following stimulation of cells with the inflammatory cytokines interleukin-1 or tumor necrosis factor-alpha. It also can be detected in eosinophils, and can be inhibited with the type II interferon. CXCL5 plays a role in reducing sensitivity to sunburn pain in some subjects, and is a potential target which can be utilized to understand more about pain in other inflammatory conditions like arthritis and cystitis. It stimulates the chemotaxis of neutrophils possesses angiogenic properties. It elicits these effects by interacting with the cell surface chemokine receptor CXCR2.

Ссылки
  • Dawes JM, et al. (2011) CXCL5 Mediates UVB Irradiation-Induced Pain. Sci Transl Med. 3(90): 90ra60.
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Persson T, et al. (2003) Expression of the neutrophil-activating CXC chemokine ENA-78/CXCL5 by human eosinophils. Clin Exp Allergy. 33(4):531-7.
  • Size / Price
    Каталог: MG50354-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».