GRO gamma cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

GRO gamma cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
303 bp
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 3.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GRO gamma cDNA ORF Clone, Mouse, untagged: Alternative Names

Dcip1 cDNA ORF Clone, Mouse; Gm1960 cDNA ORF Clone, Mouse

GRO gamma Background Information

CXCL3 is involved in migration, invasion, proliferation and tubule formation of trophoblasts and may play a key role in the pathogenesis of preeclampsia. CXCL3 autocrine/paracrine pathways are involved in the development of prostate cancer by regulating the expression of the target genes that are related to the progression of malignancies. CXCL3 is a novel adipokine that facilitates adipogenesis in an autocrine and/or a paracrine manner through induction of c/ebpb and c/ebpd. CXCL3 and its receptor CXCR2 are overexpressed in prostate cancer cells, prostate epithelial cells and prostate cancer tissues, which may play multiple roles in prostate cancer progression and metastasis.
Full Name
chemokine (C-X-C motif) ligand 3
Add to Cart Successfully Add to Cart Failed