Быстрый заказ

Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь CTSS Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_021281.3
    Размер кДНК:1023bp
    Описание кДНК:Full length Clone DNA of Mus musculus cathepsin S with N terminal His tag.
    Синоним гена:Ctss
    Виды:Mouse
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTSS qPCR primers for gene expression analysis, MP200743 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51402-ACGRBS15400
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51402-ACRRBS15400
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51402-CFRBS13340
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51402-CHRBS13340
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51402-CMRBS13340
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51402-CYRBS13340
    Мышь Cathepsin S/CTSS Джин клон кДНК в вектор клонированияMG51402-GRBS5130
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51402-NFRBS13340
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51402-NHRBS13340
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51402-NMRBS13340
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51402-NYRBS13340
    Мышь Cathepsin S/CTSS Джин ORF экспрессии кДНК клона плазмидыMG51402-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.

    Ссылки
  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.
  • Size / Price
    Каталог: MG51402-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».