Быстрый заказ

Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь CSRP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_007791.5
    Размер кДНК:582bp
    Описание кДНК:Full length Clone DNA of Mus musculus cysteine and glycine-rich protein 1 with N terminal HA tag.
    Синоним гена:CRP1, Csrp, AA408841, AA959891, AW545626, Csrp1
    Виды:Mouse
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CSRP1 qPCR primers for gene expression analysis, MP200524 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50532-ACGRBS15400
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50532-ACRRBS15400
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50532-ANGRBS15400
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50532-ANRRBS15400
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50532-CFRBS13340
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50532-CHRBS13340
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50532-CMRBS13340
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50532-CYRBS13340
    Мышь CSRP1 Джин клон кДНК в вектор клонированияMG50532-MRBS5130
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50532-NFRBS13340
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50532-NHRBS13340
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50532-NMRBS13340
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50532-NYRBS13340
    Мышь CSRP1 Джин ORF экспрессии кДНК клона плазмидыMG50532-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

    Ссылки
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • Size / Price
    Каталог: MG50532-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».