Быстрый заказ

Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CSDC2 Информация о продукте «Клон cDNA»
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Mus musculus cold shock domain containing C2, RNA binding with N terminal Myc tag.
Синоним гена:Pippin, AI415250, AI481750
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52015-ACGRBS15400
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52015-ACRRBS15400
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52015-ANGRBS15400
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52015-ANRRBS15400
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52015-CFRBS13340
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52015-CHRBS13340
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52015-CMRBS13340
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52015-CYRBS13340
Мышь CSDC2 Джин клон кДНК в вектор клонированияMG52015-GRBS5130
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52015-NFRBS13340
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52015-NHRBS13340
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52015-NMRBS13340
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52015-NYRBS13340
Мышь CSDC2 Джин ORF экспрессии кДНК клона плазмидыMG52015-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52015-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.