After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CRTAC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_145123.4
Размер кДНК:1941bp
Описание кДНК:Full length Clone DNA of Mus musculus cartilage acidic protein 1.
Синоним гена:Lotus, Crtac1B, AW047536, 2810454P21Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52469-ACGRBS16760
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52469-ACRRBS16760
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52469-CFRBS14710
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52469-CHRBS14710
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52469-CMRBS14710
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52469-CYRBS14710
Мышь CRTAC1 Джин клон кДНК в вектор клонированияMG52469-GRBS5130
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52469-NFRBS14710
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52469-NHRBS14710
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52469-NMRBS14710
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52469-NYRBS14710
Мышь CRTAC1 Джин ORF экспрессии кДНК клона плазмидыMG52469-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52469-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».