Быстрый заказ

Text Size:AAA

Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CRP Информация о продукте «Клон cDNA»
Размер кДНК:678bp
Описание кДНК:Full length Clone DNA of Mus musculus C-reactive protein, pentraxin-related with C terminal Flag tag.
Синоним гена:AI255847, Crp
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50409-ACGRBS15400
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50409-ACRRBS15400
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50409-CFRBS13340
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50409-CHRBS13340
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50409-CMRBS13340
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50409-CYRBS13340
Мышь C-Reactive Белок/CRP Джин клон кДНК в вектор клонированияMG50409-MRBS5130
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50409-NFRBS13340
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50409-NHRBS13340
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50409-NMRBS13340
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50409-NYRBS13340
Мышь C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмидыMG50409-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • Size / Price
    Каталог: MG50409-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.