After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CRABP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007759.2
Размер кДНК:417bp
Описание кДНК:Full length Clone DNA of Mus musculus cellular retinoic acid binding protein II with N terminal HA tag.
Синоним гена:Crabp-2, CrabpII, AI893628, Crabp2
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50535-ACGRBS15400
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50535-ACRRBS15400
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50535-ANGRBS15400
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50535-ANRRBS15400
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50535-CFRBS13340
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50535-CHRBS13340
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50535-CMRBS13340
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50535-CYRBS13340
Мышь CRABP2 Джин клон кДНК в вектор клонированияMG50535-MRBS5130
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50535-NFRBS13340
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50535-NHRBS13340
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50535-NMRBS13340
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50535-NYRBS13340
Мышь CRABP2 Джин ORF экспрессии кДНК клона плазмидыMG50535-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

Ссылки
  • Deak,KL.et al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Size / Price
    Каталог: MG50535-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».