After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CPE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013494.3
Размер кДНК:1431bp
Описание кДНК:Full length Clone DNA of Mus musculus carboxypeptidase E with N terminal Flag tag.
Синоним гена:CPH; fat; Cph1; Cph-1; R74677
Виды:Mouse
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51055-ACGRBS15400
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51055-ACRRBS15400
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51055-ANGRBS15400
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51055-ANRRBS15400
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51055-CFRBS5130
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51055-CHRBS13340
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51055-CMRBS13340
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51055-CYRBS13340
Mouse CPE Gene cDNA clone plasmidMG51055-GRBS5130
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51055-NFRBS13340
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51055-NHRBS13340
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51055-NMRBS13340
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51055-NYRBS13340
Мышь Carboxypeptidase E/CPE Джин клон кДНК в вектор клонированияMG51055-URBS5130
Мышь Carboxypeptidase E/CPE Джин ORF экспрессии кДНК клона плазмидыMG51055-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

Ссылки
  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Size / Price
    Каталог: MG51055-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».