Быстрый заказ

Text Size:AAA

Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CPA1 Информация о продукте «Клон cDNA»
Размер кДНК:1260bp
Описание кДНК:Full length Clone DNA of Mus musculus carboxypeptidase A1 with N terminal Flag tag.
Синоним гена:Cpa, 0910001L12Rik, Cpa1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50448-ACGRBS15400
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50448-ACRRBS15400
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50448-CFRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50448-CHRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50448-CMRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50448-CYRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин клон кДНК в вектор клонированияMG50448-MRBS5130
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50448-NFRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50448-NHRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50448-NMRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50448-NYRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмидыMG50448-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Human Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Каталог: MG50448-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.