After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CPA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025350.3
Размер кДНК:1260bp
Описание кДНК:Full length Clone DNA of Mus musculus carboxypeptidase A1 with C terminal His tag.
Синоним гена:Cpa, 0910001L12Rik, Cpa1
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50448-ACGRBS15400
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50448-ACRRBS15400
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50448-CFRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50448-CHRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50448-CMRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50448-CYRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин клон кДНК в вектор клонированияMG50448-MRBS5130
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50448-NFRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50448-NHRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50448-NMRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50448-NYRBS13340
Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмидыMG50448-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

Ссылки
  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Каталог: MG50448-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».