Быстрый заказ

Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь CPA1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_025350.3
    Размер кДНК:1260bp
    Описание кДНК:Full length Clone DNA of Mus musculus carboxypeptidase A1 with C terminal His tag.
    Синоним гена:Cpa, 0910001L12Rik, Cpa1
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CPA1 qPCR primers for gene expression analysis, MP200457 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50448-ACGRBS15400
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50448-ACRRBS15400
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50448-CFRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50448-CHRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50448-CMRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50448-CYRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин клон кДНК в вектор клонированияMG50448-MRBS5130
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50448-NFRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50448-NHRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50448-NMRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50448-NYRBS13340
    Мышь Carboxypeptidase A1/CPA1 Джин ORF экспрессии кДНК клона плазмидыMG50448-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

    Ссылки
  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Каталог: MG50448-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».