After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse COX8B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007751.3
Размер кДНК:213bp
Описание кДНК:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit VIIIb.
Синоним гена:Cox8h, CoxVIII-H
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51351-ACGRBS15400
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51351-ACRRBS15400
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51351-ANGRBS15400
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51351-ANRRBS15400
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51351-CFRBS13340
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51351-CHRBS13340
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51351-CMRBS13340
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51351-CYRBS13340
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51351-NFRBS13340
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51351-NHRBS13340
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51351-NMRBS13340
Мышь COX8B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51351-NYRBS13340
Мышь COX8B Джин клон кДНК в вектор клонированияMG51351-URBS5130
Мышь COX8B Джин ORF экспрессии кДНК клона плазмидыMG51351-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51351-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».