Быстрый заказ

Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь COX7A2L Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_009187.3
    Размер кДНК:336bp
    Описание кДНК:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit VIIa polypeptide 2-like.
    Синоним гена:EB1, SIG81, COX7AR, COX7RP, SIG-81, Silg81
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COX7A2L qPCR primers for gene expression analysis, MP201226 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51349-ACGRBS15400
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51349-ACRRBS15400
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51349-ANGRBS15400
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51349-ANRRBS15400
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51349-CFRBS13340
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51349-CHRBS13340
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51349-CMRBS13340
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51349-CYRBS13340
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51349-NFRBS13340
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51349-NHRBS13340
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51349-NMRBS13340
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51349-NYRBS13340
    Мышь COX7A2L Джин клон кДНК в вектор клонированияMG51349-URBS5130
    Мышь COX7A2L Джин ORF экспрессии кДНК клона плазмидыMG51349-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51349-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».