After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse COX6C Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053071.2
Размер кДНК:231bp
Описание кДНК:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit Vic.
Синоним гена:Cox6c
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51387-ACGRBS15400
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51387-ACRRBS15400
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51387-ANGRBS15400
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51387-ANRRBS15400
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51387-CFRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51387-CHRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51387-CMRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51387-CYRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51387-NFRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51387-NHRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51387-NMRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51387-NYRBS13340
Мышь Cytochrome C Oxidase subunit VIc Джин клон кДНК в вектор клонированияMG51387-URBS5130
Мышь Cytochrome C Oxidase subunit VIc Джин ORF экспрессии кДНК клона плазмидыMG51387-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51387-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».