Быстрый заказ

Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse COPS4 Информация о продукте «Клон cDNA»
Размер кДНК:1221bp
Описание кДНК:Full length Clone DNA of Mus musculus COP9 (constitutive photomorphogenic) homolog, subunit 4 (Arabidopsis thaliana) with C terminal HA tag.
Синоним гена:AW208976; D5Ertd774e
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51781-ACGRBS15400
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51781-ACRRBS15400
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51781-ANGRBS15400
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51781-ANRRBS15400
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51781-CFRBS13340
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51781-CHRBS13340
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51781-CMRBS13340
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51781-CYRBS13340
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51781-NFRBS13340
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51781-NHRBS13340
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51781-NMRBS13340
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51781-NYRBS13340
Мышь COPS4 Джин клон кДНК в вектор клонированияMG51781-URBS5130
Мышь COPS4 Джин ORF экспрессии кДНК клона плазмидыMG51781-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.