COMT cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52235-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All COMT Reagents

CRO Services

Product recommended


All COMT Reagents

COMT cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
798 bp
Description
Full length Clone DNA of Mouse catechol-O-methyltransferase with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COMT cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

Comt1 cDNA ORF Clone, Mouse;D16Wsu103e cDNA ORF Clone, Mouse;D330014B15Rik cDNA ORF Clone, Mouse

COMT Background Information

Full Name
catechol-O-methyltransferase

COMT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COMT cDNA ORF Clone in Cloning Vector, Mouse MG52235-G
COMT cDNA ORF Clone, Mouse, untagged MG52235-UT
COMT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52235-ACGLN
COMT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52235-ACG
COMT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52235-ANG
COMT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52235-ACR
COMT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52235-ANR
COMT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52235-CF
COMT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52235-NF
COMT cDNA ORF Clone, Mouse, C-His tag MG52235-CH
COMT cDNA ORF Clone, Mouse, N-His tag MG52235-NH
COMT cDNA ORF Clone, Mouse, C-HA tag MG52235-CY
COMT cDNA ORF Clone, Mouse, N-HA tag MG52235-NY
COMT cDNA ORF Clone, Mouse, N-Myc tag MG52235-NM
COMT qPCR Primer Pairs, Mouse MP202108

COMT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COMT cDNA ORF Clone in Cloning Vector, Human HG12040-U
COMT cDNA ORF Clone, Human, untagged HG12040-UT
COMT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12040-ACGLN
COMT cDNA ORF Clone, Human, C-GFPSpark® tag HG12040-ACG
COMT cDNA ORF Clone, Human, C-OFPSpark® tag HG12040-ACR
COMT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12040-CF
COMT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12040-NF
COMT cDNA ORF Clone, Human, C-His tag HG12040-CH
COMT cDNA ORF Clone, Human, N-His tag HG12040-NH
COMT cDNA ORF Clone, Human, C-HA tag HG12040-CY
COMT cDNA ORF Clone, Human, N-HA tag HG12040-NY
COMT cDNA ORF Clone, Human, C-Myc tag HG12040-CM
COMT cDNA ORF Clone, Human, N-Myc tag HG12040-NM
COMT qPCR Primer Pairs, Human HP101574
info info
添加购物车成功! 添加购物车失败!