After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse COLEC11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027866.1
Размер кДНК:819bp
Описание кДНК:Full length Clone DNA of Mus musculus collectin sub-family member 11 with N terminal Myc tag.
Синоним гена:MGC129470, MGC129471, 1010001H16Rik, Colec11
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50195-ACGRBS15396
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50195-ACRRBS15396
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50195-CFRBS13343
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50195-CHRBS13343
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50195-CMRBS13343
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50195-CYRBS13343
Мышь CL-K1/COLEC11 Джин клон кДНК в вектор клонированияMG50195-MRBS5132
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50195-NFRBS13343
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50195-NHRBS13343
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50195-NMRBS13343
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50195-NYRBS13343
Мышь CL-K1/COLEC11 Джин ORF экспрессии кДНК клона плазмидыMG50195-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50195-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».