Быстрый заказ

Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь CNP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009923.2
Размер кДНК:1263bp
Описание кДНК:Full length Clone DNA of Mus musculus 2',3'-cyclic nucleotide 3' phosphodiesterase with N terminal His tag.
Синоним гена:Cnp1; Cnp-1; CNPase
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CNP qPCR primers for gene expression analysis, MP201263 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51390-ACGRBS15400
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51390-ACRRBS15400
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51390-ANGRBS15400
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51390-ANRRBS15400
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51390-CFRBS13340
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51390-CHRBS13340
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51390-CMRBS13340
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51390-CYRBS13340
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51390-NFRBS13340
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51390-NHRBS13340
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51390-NMRBS13340
Мышь CNPase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51390-NYRBS13340
Мышь CNPase Джин клон кДНК в вектор клонированияMG51390-URBS5130
Мышь CNPase Джин ORF экспрессии кДНК клона плазмидыMG51390-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51390-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».