Быстрый заказ

Text Size:AAA

Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CMBL Информация о продукте «Клон cDNA»
Размер кДНК:738bp
Описание кДНК:Full length Clone DNA of Mus musculus carboxymethylenebutenolidase-like (Pseudomonas) with N terminal His tag.
Синоним гена:2310016A09Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51405-ACGRBS15400
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51405-ACRRBS15400
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51405-ANGRBS15400
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51405-ANRRBS15400
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51405-CFRBS13340
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51405-CHRBS13340
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51405-CMRBS13340
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51405-CYRBS13340
Мышь CMBL Джин клон кДНК в вектор клонированияMG51405-GRBS5130
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51405-NFRBS13340
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51405-NHRBS13340
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51405-NMRBS13340
Мышь CMBL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51405-NYRBS13340
Мышь CMBL Джин ORF экспрессии кДНК клона плазмидыMG51405-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Carboxymethylenebutenolidase (CMBL), also known as 4-carboxymethylenebut-2-en-4-olide lactonohydrolase, maleylacetate enol- lactonase, dienelactone hydrolase, and carboxymethylene butenolide hydrolase, is a hydrolase specially belonging to the family of hydrolases. It maily acts on carboxylic ester bonds. CMBL is a human homolog of Pseudomonas dienelactone hydrolase involved in the bacterial halocatechol degradation pathway. The ubiquitous expression of human CMBL gene transcript in various tissues was observed. CMBL was demonstrated to be the primary olmesartan medoxomil (OM) bioactivating enzyme in the liver and intestine. The recombinant human CMBL expressed in mammalian cells was clearly shown to activate OM. The recombinant CMBL also converted other prodrugs having the same ester structure as OM, faropenem medoxomil and lenampicillin, to their active metabolites. CMBL exhibited a unique sensitivity to chemical inhibitors, thus, being distinguishable from other known esterases.  

  • Ishizuka T, et al. (2010) Human Carboxymethylenebutenolidase as a Bioactivating Hydrolase of Olmesartan Medoxomil in Liver and Intestine. The Journal of Biological Chemistry. 285: 11892-902.
  • Schmidt E, et al. (1980) Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid. Biochem J. 192 (1): 339-47.
  • Size / Price
    Каталог: MG51405-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.