Быстрый заказ

Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CLMP Информация о продукте «Клон cDNA»
Размер кДНК:1122bp
Описание кДНК:Full length Clone DNA of Mus musculus RIKEN c DNA.9030425E11 gene with N terminal HA tag.
Синоним гена:ACAM, ASP5, CLMP, AW557819, 9030425E11Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50553-ACGRBS15400
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50553-ACRRBS15400
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50553-CFRBS13340
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50553-CHRBS13340
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50553-CMRBS13340
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50553-CYRBS13340
Мышь ASAM / CLMP Джин клон кДНК в вектор клонированияMG50553-MRBS5130
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50553-NFRBS13340
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50553-NHRBS13340
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50553-NMRBS13340
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50553-NYRBS13340
Мышь ASAM / CLMP Джин ORF экспрессии кДНК клона плазмидыMG50553-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a member of the CTX (cortical thymocyte marker in Xenopus) family within the immunoglobulin superfamily. ASAM protein is highly expressed in the small intestine and placenta, and is found at intermediate levels in the heart, skeletal muscle, colon, spleen, kidney, and lung, and appears in low levels in the liver and peripheral blood leukocytes as well. ASAM is a transmembrane component of tight junctions in epithelial cells that can mediate cell aggregation and regulate transepithelial resistance across polarized epithelial cells. In addition, its expression is strongly correlated with white adipose tissue (WAT) mass of human and rodents with obesity.

  • Eguchi J, et al. (2005) Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 387(Pt 2): 343-53.
  • Sze KL, et al. (2008) Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 214(2): 334-44.
  • Sze KL, et al. (2008) Post-transcriptional regulation of CLMP mRNA is controlled by tristetraprolin in response to TNFalpha via c-Jun N-terminal kinase signalling. Biochem J. 410(3): 575-83.
  • Size / Price
    Каталог: MG50553-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.