After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CLEC4F Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016751.3
Размер кДНК:1647bp
Описание кДНК:Full length Clone DNA of Mus musculus C-type lectin domain family 4, member f.
Синоним гена:Kclr, D18063, Clecsf13, KUCR_MOUSE, Clec4f
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50282-ACGRBS16760
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50282-ACRRBS16760
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50282-CFRBS14710
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50282-CHRBS14710
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50282-CMRBS14710
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50282-CYRBS14710
Мышь CLEC4F / CLECSF13 Джин клон кДНК в вектор клонированияMG50282-MRBS5130
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50282-NFRBS14710
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50282-NHRBS14710
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50282-NMRBS14710
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50282-NYRBS14710
Мышь CLEC4F / CLECSF13 Джин ORF экспрессии кДНК клона плазмидыMG50282-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CLEC4F, a member of C-type lectins, was firstly purified from rat liver extract with high binding affinity to fucose, galactose and N-acetylgalactosamine, and un-sialylated glucosphingolipids with GalNAc or Gal terminus. However, the biological functions of CLEC4F have not been elucidated. Histochemical staining showed that mouse CLEC4F(mCLEC4F) is only expressed on F4/80+ cells localized in liver, and is undetectable in bone marrow, spleen, lymph nodes, or other tissues in adult mice. However, mCLEC4F is detected in the liver of embryonic day 11.5 (E11.5), which is 1.5 day earlier than the formation of liver (E10) and is 3.5 day earlier than the formation of bone marrow (E15-16). Moreover, recombinant mCLEC4F.Fc binds to alpha-galactoceramide in a Ca++-dependent manner, and both galactose and ceramide can partially inhibit CLEC4F.Fc binding to alpha-galactoceramide. Interestingly, mCLEC4F-deficient (mCEC4F k/o) mice produced far less cytokines than wild type littermates after intravenous injection ofalpha-galactoceramide. This suggests that mCLEC4F is not only a specific marker for Kupffer cells, but is also critical for the presentation of glycolipid antigen to NKT cells.

Ссылки
  • Shie-Liang Edmond Hsieh, et al. (2009) CLEC4F, A Kupffer Cells Specific Marker, Is Critical for Presentation of Alfa-Galactoceromide to NKT Cells. The Journal of Immunology. 182:78.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 2004 Jan;36(1):40-5.
  • Bonaldo MF, et al. (1996) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 1996 Sep;6(9):791-806.
  • Size / Price
    Каталог: MG50282-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».