After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CLEC11A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009131.3
Размер кДНК:987bp
Описание кДНК:Full length Clone DNA of Mus musculus C-type lectin domain family 11, member a with C terminal Myc tag.
Синоним гена:Scgf, Clecsf3, AW457320, Clec11a
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50334-ACGRBS15400
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50334-ACRRBS15400
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50334-CFRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50334-CHRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50334-CMRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50334-CYRBS13340
Мышь SCGF/CLEC11A Джин клон кДНК в вектор клонированияMG50334-MRBS5130
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50334-M-FRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50334-NFRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50334-NHRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50334-NMRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50334-NYRBS13340
Мышь SCGF/CLEC11A Джин ORF экспрессии кДНК клона плазмидыMG50334-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50334-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».