Claudin-11 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

Claudin-11 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Mouse claudin 11 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Claudin-11 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

Claudin-11 cDNA ORF Clone, Mouse; Claudin11 cDNA ORF Clone, Mouse; Osp cDNA ORF Clone, Mouse; Otm cDNA ORF Clone, Mouse

Claudin-11 Background Information

Claudin-11, also known as CLDN11, belongs to the group of claudins. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands function as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions.Claudin-11 is a tight junction associated protein and is a major component of central nervous system (CNS) myelin that is necessary for normal CNS function. Human blood-testis barrier disruption is related to a dysfunction of CLDN11 gene. It plays an important role in regulating proliferation and migration of oligodendrocytes.
Full Name
claudin 11
References
  • Tsukita S, et al. (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2(4): 285-3.
  • Heiskala M, et al. (2001) The roles of claudin superfamily proteins in paracellular transport. Traffic 2. (2):93-8.
  • Bronstein JM, et al. (2000) Involvement of OSP/claudin-11 in oligodendrocyte membrane interactions: role in biology and disease. J Neurosci Res. 59(6):706-11.

Claudin-11 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait