After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CLDN11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008770.3
Размер кДНК:624bp
Описание кДНК:Full length Clone DNA of Mus musculus claudin 11 with N terminal Myc tag.
Синоним гена:Osp, Otm, Claudin11, Claudin-11
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51441-ACGRBS15400
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51441-ACRRBS15400
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51441-ANGRBS15400
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51441-ANRRBS15400
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51441-CFRBS13340
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51441-CHRBS13340
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51441-CMRBS13340
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51441-CYRBS13340
Мышь CLDN11 / Claudin-11 Джин клон кДНК в вектор клонированияMG51441-GRBS5130
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51441-NFRBS13340
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51441-NHRBS13340
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51441-NMRBS13340
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51441-NYRBS13340
Мышь CLDN11 / Claudin-11 Джин ORF экспрессии кДНК клона плазмидыMG51441-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Claudin-11, also known as CLDN11, belongs to the group of claudins. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands function as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions.Claudin-11 is a tight junction associated protein and is a major component of central nervous system (CNS) myelin that is necessary for normal CNS function. Human blood-testis barrier disruption is related to a dysfunction of CLDN11 gene. It plays an important role in regulating proliferation and migration of oligodendrocytes.

Ссылки
  • Tsukita S, et al. (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2(4): 285-3.
  • Heiskala M, et al. (2001) The roles of claudin superfamily proteins in paracellular transport. Traffic 2. (2):93-8.
  • Bronstein JM, et al. (2000) Involvement of OSP/claudin-11 in oligodendrocyte membrane interactions: role in biology and disease. J Neurosci Res. 59(6):706-11.
  • Size / Price
    Каталог: MG51441-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».