After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CKMT2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_198415.2
Размер кДНК:1260bp
Описание кДНК:Full length Clone DNA of Mus musculus creatine kinase, mitochondrial 2 with C terminal His tag.
Синоним гена:ScCKmit, 2300008A19Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53058-ACGRBS15400
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53058-ACRRBS15400
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53058-CFRBS13340
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53058-CHRBS13340
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53058-CMRBS13340
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53058-CYRBS13340
Мышь CKMT2 / S-MTCK Джин клон кДНК в вектор клонированияMG53058-GRBS5130
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53058-NFRBS13340
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53058-NHRBS13340
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53058-NMRBS13340
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53058-NYRBS13340
Мышь CKMT2 / S-MTCK Джин ORF экспрессии кДНК клона плазмидыMG53058-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».