After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CKM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:X03233.1
Размер кДНК:1146bp
Описание кДНК:Full length Clone DNA of Mus musculus creatine kinase, muscle.
Синоним гена:MCK, Ckmm, M-CK
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51356-ACGRBS15400
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51356-ACRRBS15400
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51356-ANGRBS15400
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51356-ANRRBS15400
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51356-CFRBS13340
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51356-CHRBS13340
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51356-CMRBS13340
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51356-CYRBS13340
Мышь CKM / CK-MM Джин клон кДНК в вектор клонированияMG51356-GRBS5130
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51356-NFRBS13340
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51356-NHRBS13340
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51356-NMRBS13340
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51356-NYRBS13340
Мышь CKM / CK-MM Джин ORF экспрессии кДНК клона плазмидыMG51356-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also can be detected in heart muscle. CKM is a subunit of creatine kinase (CK). CK is an enzyme expressed by various tissues and cell types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In the cells, the cytosolic CK enzymes consist of two subunits, which can be either B (brain type) or M (muscle type).

Ссылки
  • Goldblatt H. 1969, Laboratory Investigation. 21 (2): 126-8.
  • Hekimsoy Zeliha. et al., 2005, Endocrine Research. 31 (3): 171-5.
  • Döring F. et al., 2011, Scand J Med Sci Sports. 21(6):841-5.
  • Size / Price
    Каталог: MG51356-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».