After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CKB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_021273.4
Размер кДНК:1146bp
Описание кДНК:Full length Clone DNA of Mus musculus creatine kinase, brain.
Синоним гена:Bck, Ck3, B-CK, Ck-3, Ckbb
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51386-ACGRBS15400
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51386-ACRRBS15400
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51386-ANGRBS15400
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51386-ANRRBS15400
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51386-CFRBS13340
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51386-CHRBS13340
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51386-CMRBS13340
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51386-CYRBS13340
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51386-NFRBS13340
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51386-NHRBS13340
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51386-NMRBS13340
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51386-NYRBS13340
Мышь CKB / Creatine kinase B type Джин клон кДНК в вектор клонированияMG51386-URBS5130
Мышь CKB / Creatine kinase B type Джин ORF экспрессии кДНК клона плазмидыMG51386-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

Ссылки
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Каталог: MG51386-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».