Быстрый заказ

Text Size:AAA

Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CIB2 Информация о продукте «Клон cDNA»
Размер кДНК:564bp
Описание кДНК:Full length Clone DNA of Mus musculus calcium and integrin binding family member 2 with N terminal Myc tag.
Синоним гена:AI449053, 2810434I23Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52594-ACGRBS15400
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52594-ACRRBS15400
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52594-ANGRBS15400
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52594-ANRRBS15400
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52594-CFRBS13340
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52594-CHRBS13340
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52594-CMRBS13340
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52594-CYRBS13340
Мышь CIB2 Джин клон кДНК в вектор клонированияMG52594-GRBS5130
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52594-NFRBS13340
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52594-NHRBS13340
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52594-NMRBS13340
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52594-NYRBS13340
Мышь CIB2 Джин ORF экспрессии кДНК клона плазмидыMG52594-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Blazejczyk M, et al. (2006) Myristoylation and membranous localization of Calmyrin2, a new member of Neuronal Calcium-Sensor proteins. FENS Forum Abstracts. 3.
  • Hollenbach AD, et al. (2006) The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1574(3): 321-8.
  • Blazejczyk M, et al. (2009) Biochemical characterization and expression analysis of a novel EF-hand Ca2+ binding protein calmyrin2 (Cib2) in brain indicates its function in NMDA receptor mediated Ca2+ signaling. Archives of Biochemistry and Biophysics. 487(1): 66-78.
  • Size / Price
    Каталог: MG52594-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.