After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse CHMP2A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026885.3
Размер кДНК:669bp
Описание кДНК:Full length Clone DNA of Mus musculus charged multivesicular body protein 2A with N terminal His tag.
Синоним гена:1500016L11Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52820-ACGRBS15400
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52820-ACRRBS15400
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52820-ANGRBS15400
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52820-ANRRBS15400
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52820-CFRBS13340
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52820-CHRBS13340
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52820-CMRBS13340
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52820-CYRBS13340
Мышь CHMP2A Джин клон кДНК в вектор клонированияMG52820-GRBS5130
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52820-NFRBS13340
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52820-NHRBS13340
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52820-NMRBS13340
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52820-NYRBS13340
Мышь CHMP2A Джин ORF экспрессии кДНК клона плазмидыMG52820-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52820-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».